Mouse Carbonic Anhydrase XII Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGB104-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065bp
Gene Synonym
AI314958, 2310047E01Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse carbonic anyhydrase 12 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA12, also known as Car12 and carbonic anhydrase XII, is a type I  membrane enzyme of an N-terminal extracellular catalytic domain, a membrane-spanning α-helix, and a small intracellular C-terminal domain. It is highly expressed in colon, kidney, prostate, intestine and activated lymphocytes and moderately expressed in pancreas, ovary, and testis. Overexpression of the CA12 is observed in certain human cancers and is used as a tumor marker. rmCA12 corresponds to the extracellular domain and has both carbonic anhydrase activity and esterase activity.
References
  • Sahin, U. et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 92 (25): 11810–11813.
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596 - 12601.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 16903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • TOP