Rat Carbonic Anhydrase III Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

BC061980.1

RefSeq ORF Size

783bp

Gene Synonym

Ca3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat carbonic anhydrase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases (CAs) form a family of enzymes that catalyze the rapid conversion of carbon dioxide and water to bicarbonate and protons, a reaction that occurs rather slowly in the absence of a catalyst. The active site of most carbonic anhydrases contains a zinc ion, they are therefore classified as metalloenzymes. Several forms of carbonic anhydrase occur in nature. The primary function of the enzyme in animals is to interconvert carbon dioxide and bicarbonate to maintain acid-base balance in blood and other tissues, and to help transport carbon dioxide out of tissues. Plants contain a different form called β-carbonic anhydrase, which, from an evolutionary standpoint, is a distinct enzyme, but participates in the same reaction and also uses a zinc ion in its active site.

References

Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596-601.

Sowden J. et al., 1998, Gene 214:157- 65.

Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899-903.

Liao, S.Y. et al., 2003, J. Med. Genet. 40: 257-62.

Bataller,L. et al., 2004, Ann Neurol 56 (4): 575-9.

Catalog Number:MGB096-NY