Mouse CANT1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_029502.3

RefSeq ORF Size

1212bp

Gene Synonym

Apy1h; Shapy; Entpd8; SCAN-1; D11Bwg0554e; 5830420C20Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse calcium activated nucleotidase 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can also activate it) (EC 3.6.1.5) that catalyses the hydrolysis of ATP to yield AMP and inorganic phosphate. Two isoenzymes are found in commercial preparations from S. tuberosum. One with a higher ratio of substrate selectivity for ATP: ADP and another with no selectivity. It can also act on ADP and other nucleoside triphosphates and diphosphates with the general reaction being NTP -> NDP + Pi -> NMP + 2Pi. The salivary apyrases of blood-feeding arthropods are nucleotide hydrolysing enzymes are implicated in the inhibition of host platelet aggregation through the hydrolysis of extracellular adenosine diphosphate. CANT1 functions as a calcium-dependent nucleotidase with a preference for UDP. Defects in CANT1 are the cause of desbuquois dysplasia.

References

Failer BU, et al. (2002) Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase. J Biol Chem. 277(40):36978-86.

Smith TM, et al. (2002) Cloning, expression, and characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a new family of extracellular nucleotidases. Arch Biochem Biophys. 406(1):105-15.

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Catalog Number:MGB082-NO