Mouse CAMK2A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009792.3

RefSeq ORF Size

603bp

Gene Synonym

CaMKII, R74975, mKIAA0968, Camk2a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase II alpha Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ca²⁺/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca²⁺/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca²⁺ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

References

Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.

Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.

Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.

Catalog Number:MGB074-NY