Mouse CADM4/IGSF4C/NECL-4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_153112.3

RefSeq ORF Size

1167bp

Gene Synonym

Tsll2, Igdf4c, Igsf4c, Cadm4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cell adhesion molecule 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

References

Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.

Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.

Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.

Catalog Number:MGB043-CF