Rat CADM3/NECL1/IGSF4B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB041-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1191bp
Gene Synonym
Igsf4b, Necl-1, Cadm3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cell adhesion molecule 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either with other CAMs of the same kind (homophilic binding) or with other CAMs or the extracellular matrix (heterophilic binding). Cell adhesion molecule 3, also known as Immunoglobulin superfamily member 4B, CADM3, and NECL1, is a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule which has Ca(2+)-independent homo- or heterophilic cell-cell adhesion activity and plays an important role in the formation of synapses, axon bundles and myelinated axons. Isoform 1 of CADM3 is expressed mainly in adult and fetal brain. Isoform 2 of CADM3 is highly expressed in adult brain and weakly expressed in placenta. In brain, Isoform 2 is highly expressed in cerebellum. CADM3 is involved in the cell-cell adhesion. It has both calcium-independent homophilic cell-cell adhesion activity and calcium-independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. The interaction with EPB41L1 may regulate structure or function of cell-cell junctions. CADM3 may act as a tumor suppressor in glioma and loss of it in glioma may be caused by histone deacetylation.
References
  • Dong X, et al. (2006) Crystal structure of the V domain of human Nectin-like molecule-1/Syncam3/Tsll1/Igsf4b, a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule. J Biol Chem. 281(15): 10610-7.
  • Gao J, et al. (2008) Nectin-like molecule 1 is a glycoprotein with a single N-glycosylation site at N290KS which influences its adhesion activity. Biochim Biophys Acta. 1778(6): 1429-35.
  • Gao J, et al. (2009) Loss of NECL1, a novel tumor suppressor, can be restored in glioma by HDAC inhibitor-Trichostatin A through Sp1 binding site. Glia. 57(9): 989-99.
  • TOP