Mouse C1qB Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGA971-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
762bp
Gene Synonym
C1QB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent, beta polypeptide Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Southern blot analysis of chromosomal DNA from vertebrate species demonstrated highest similarity between the C1qB genes, followed by C1qC and finally C1qA. Sequence comparison of C1q from three different species have shown that the B chains have the strongest similarity. C1q was already present at embryonic day 14 (E14) and showed little change in abundance through six weeks postnatal. At E16, C1qB mRNA was present at high abundance in putative microglia/macrophages in cortical marginal and intermediate zones, and hippocampal analge.
References
  • Pasinetti GM, et al. (1992) Complement C1qB and C4 mRNAs responses to lesioning in rat brain. Experimental neurology. 118(2): 117-25.
  • Johnson SA, et al. (1994) Expression of complement C1qB and C4 mRNAs during rat brain development. Brain Res Dev Brain Res. 80(1-2): 163-74.
  • Grewal RP,et al. (1999) C1qB and clusterin mRNA increase in association with neurodegeneration in sporadic amyotrophic lateral sclerosis. Neuroscience letters. 271(1): 65-7.
  • Spielman L, et al. (2002) Induction of the complement component C1qB in brain of transgenic mice with neuronal overexpression of human cyclooxygenase-2. Acta neuropathologica. 103(2): 157-62.
  • TOP