Mouse C1D Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGA955-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
426bp
Gene Synonym
SUN-CoR, AI875855, 1110036E10Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse C1D nuclear receptor co-repressor Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear receptor corepressorinteracts with TSNAX and DNA-PKcs. It acts as a corepressor for the thyroid hormone receptor. It is thought that C1D nuclear receptor corepressor regulates TRAX/Translin complex formation. It is expressed in kidney, heart, brain, spleen, lung, testis, liver and small intestine. It plays a role in the recruitment of the RNA exosome complex to pre-rRNA to mediate the 3'-5' end processing of the 5.8S rRNA; this function may include MPHOSPH6. It potentiates transcriptional repression by NR1D1 and THRB. C1D nuclear receptor corepressorcan activate PRKDC not only in the presence of linear DNA but also in the presence of supercoiled DNA. It also can induce apoptosis in a p53/TP53 dependent manner.
References
  • Schilders G, et al. (2007) C1D is a major autoantibody target in patients with the polymyositis-scleroderma overlap syndrome. Arthritis Rheum.56(7):2449-54.
  • Schilders G, et al. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res. 35(8):2564-72.
  • Erdemir T, et al. (2002) DNA damage-dependent interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX). J Cell Sci. 115(Pt 1):207-16.
  • TOP