Mouse C-Src Kinase / CSK Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007783.2

RefSeq ORF Size

1353bp

Gene Synonym

AW212630, Csk

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse c-src tyrosine kinase Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

References

Brauninger A. et al.,1992, Gene. 110: 205-11.

Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.

Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.

Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.

Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.

Catalog Number:MGA913-CF