Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_013482.2

RefSeq ORF Size

2025 bp

Gene Synonym

AI528679,xid

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Bruton agammaglobulinemia tyrosine kinase Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

KpnI + NotI(6kb+2.03kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References

Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.

Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.

Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.

Catalog Number:MGA878-CO