Rat BMP-3b/GDF-10 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGA835-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1431bp
Gene Synonym
Gdf10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat growth differentiation factor 10 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BMP-3b / GDF-10 is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. In the bone morphogenetic cascade, cartilage differentiation, hypertrophy, and cell death are followed by bone formation. In this regard, all BMPs are cartilage morphogenetic proteins since cartilage is formed first. An overexpression or dysregulation of BMP pathways may lead to heterotopic bone formation or fibrodysplasia ossificans progressiva (FOP). BMPs have been implicated in FOP. The pioneering work of Sakou has implicated BMP-3b / GDF-10 in ossification of the posterior longitudinal ligament of the spine in Japanese patients. The BMP-specific antagonists such as noggin or chordin might be used therapeutically in clinical conditions with pathologically excessive bone formation. The osteoinductive capacity of BMPs has been demonstrated in preclinical models, and the efficacy of BMPs for the treatment of orthopaedic patients is now being evaluated in clinical trials. It was suggested that further progress in the clinical application of the BMP-3b / GDF-10 will depend upon the development of carriers with ideal release kinetics for the delivery of the BMPs.
References
  • Hino J, Takao M, Takeshita N, et al. (1996). "cDNA cloning and genomic structure of human bone morphogenetic protein-3B (BMP-3b).". Biochem. Biophys. Res. Commun. 223 (2): 304–10.
  • Kimura K, Toyooka S, Tsukuda K, et al. (2008). "The aberrant promoter methylation of BMP3b and BMP6 in malignant pleural mesotheliomas.". Oncol. Rep. 20 (5): 1265-8.
  • A. H. Reddi. (2001) Bone Morphogenetic Proteins: From Basic Science to Clinical Applications. Scientific Article. 83:1-6.
  • TOP