Mouse BIK Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGA813-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
453bp
Gene Synonym
Blk, Nbk, Biklk, Bik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse BCL2-interacting killer Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The BIN1 protein, which is encoded by the BIN1 gene, belongs to Myc-interacting protein family which is one of the nucleocytoplasmic adaptor proteins. The BIN1 protein can interact with the functionally critically Myc-box region at the N-terminal of the Myc oncoprotein, with a feature of tumor suppressor. Myc family proteins promote proliferation, growth, and apoptosis and, when deregulated, are profoundly involved in the genesis of an extraordinarily wide range of cancers. Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally significant because ectopic expression of BIN1 inhibited the growth of tumour cells lacking endogenous message. We conclude that BIN1 is an MYC-interacting protein with features of a tumour suppressor.
References
  • Boyd J.M., et al.,(1995), Bik, a novel death-inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11:1921-1928.
  • Han J., et al., (1996), Induction of apoptosis by human Nbk/Bik, a BH3-containing protein that interacts with E1B 19K.Mol. Cell. Biol. 16:5857-5864.
  • Hegde R., et al.,(1998), Blk, a BH3-containing mouse protein that interacts with Bcl-2 and Bcl-xL, is a potent death agonist.J. Biol. Chem. 273:7783-7786.
  • TOP