Canine BDNF/ANON2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA785-CM

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
744bp
Gene Synonym
BDNF
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine brain-derived neurotrophic factor Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.
References
  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.
  • TOP