Mouse BCL2L1/Bcl-XL Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009743.4

RefSeq ORF Size

702bp

Gene Synonym

BclX, Bcl2l, bcl-x, Bcl-XL, Bcl-Xs, Bcl(X)L, MGC99998, MGC113803

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse BCL2-like 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1) , belongs to the Bcl-2 family. Members of the bcl-2 family encode proteins that function either to promote or to inhibit apoptosis. Antiapoptotic members such as Bcl-2 and Bcl-xL prevent PCD in response to a wide variety of stimuli to take part in cancer survival. Conversely, proapoptotic proteins, exemplified by Bax and Bak, can accelerate death and in some instances are sufficient to cause apoptosis independent of additional signals. The crystal and solution structures of a Bcl-2 family member, Bcl-xL is like this: The structures consist of two central, primarily hydrophobic α-helices, which are surrounded by amphipathic helices. A 60-residue loop connecting helices αl and α2 was found to be flexible and non-essential for anti-apoptotic activity. Bcl-xL is chareacterized as important factors in autophagy, inhibiting Beclin 1-mediated autophagy by binding to Beclin 1. In addition, Beclin 1, Bcl-2 and Bcl-xL can cooperate with Atg5 or Ca²⁺ to regulate both autophagy and apoptosis. Bcl-xL is also implicated in anoxia induced cell death. The pathway is initiated by the loss of function of the prosurvival Bcl-2 family members Mcl-1 and Bcl-2 / Bcl-XL, resulting in Bax- or Bak-dependent release of cytochrome c and subsequent caspase-9-dependent cell death. Thus, Bcl-xL, the well-characterized apoptosis guards, appears to be important in cell death.

References

Vander Heiden MG, et al. (1997) Bcl-xL Regulates the Membrane Potential and Volume Homeostasis of Mitochondria. Cell. 91 (5): 627-37.

Muchmore SW, et al. (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature. 381: 335-341.

SharoffEH, et al. (2007) Bcl-2 family members regulate anoxia-induced cell death. Antioxid Redox Signal. 9 (9) :1405-9.

Zhou F, et al. (2011) Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278 (3): 403-13.

Catalog Number:MGA773-NM