Mouse BCHE/Butyrylcholinesterase Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA765-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1812bp
Gene Synonym
MGC107651, C730038G20Rik, Bche
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse butyrylcholinesterase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.
References
  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • TOP