Mouse BACE2 / Beta secretase 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGA729-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1545bp
Gene Synonym
ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, AI850424, 1110059C24Rik, Bace2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse beta-site APP-cleaving enzyme 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.
References
  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • TOP