Mouse B7-H4/Vtcn1/B7S1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGA720-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
852bp
Gene Synonym
B7x, B7S1, B7h4, B7-H4, BC032925, MGC41287
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse V-set domain containing T cell activation inhibitor 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.
References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • TOP