Mouse B4GALT1/GGTB2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGA713-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1200bp
Gene Synonym
GalT, Ggtb, Ggtb2, AA407245, B-1, 4-GalT, B4galt1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.
References
  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • TOP