Mouse AXL Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGA690-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2667bp
Gene Synonym
Ark, Ufo, Tyro7, AI323647, Axl
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse AXL receptor tyrosine kinase Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine kinases. In the nervous system, Axl and its ligand Growth-arrest-specific protein 6 (Gas6) are expressed on multiple cell types. Axl functions in dampening the immune response, regulating cytokine secretion, clearing apoptotic cells and debris, and maintaining cell survival. Axl is upregulated in various disease states, such as in the cuprizone toxicity-induced model of demyelination and in multiple sclerosis (MS) lesions, suggesting that it plays a role in disease pathogenesis. Axl expression correlates with poor prognosis in several cancers. Axl mediates multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Axl contributes to cell survival, migration, invasion, metastasis and chemosensitivity justify further investigation of Axl as novel therapeutic targets in cancer. The receptor tyrosine kinase AXL is thought to play a role in metastasis. The soluble AXL receptor as a therapeutic candidate agent for treatment of metastatic ovarian cancer. GAS6/AXL targeting as an effective strategy for inhibition of metastatic tumor progression in vivo.
References
  • Weinger JG, et al. (2011) Loss of the receptor tyrosine kinase Axl leads to enhanced inflammation in the CNS and delayed removal of myelin debris during Experimental Autoimmune Encephalomyelitis. J Neuroinflammation. 8: 49.
  • Linger RM, et al. (2010) Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors. Expert Opin Ther Targets. 14(10): 1073-90.
  • Cavet ME, et al. (2010) Gas6-Axl pathway: the role of redox-dependent association of Axl with nonmuscle myosin IIB. Hypertension. 56(1): 105-11.
  • Rankin EB, et al. (2010) AXL is an essential factor and therapeutic target for metastatic ovarian cancer. Cancer Res. 70(19): 7570-9.
  • TOP