Mouse ASAH2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGA581-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2271bp
Gene Synonym
AI585898
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse N-acylsphingosine amidohydrolase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ASAH2 (N-acylsphingosine amidohydrolase 2), also known as neutral ceramidase, is a type II integral membrane protein that can be cleaved to produce a soluble secreted protein. The enzyme is abundant in the brush border membranes of the intestine, and also expressed in several tissues such as kidney, brain and liver. The primary structure of ASAH2/neutral ceramidase is highly conserved from bacteria to humans, however, there is a clear difference in the molecular architecture. The murine ASAH2 possesses ‘amucin box’, a Ser/Thr/Pro-rich domain glycosylated with O-glycans which is necessary to retain the enzyme on the plasma membrane as a type II integral protein. The major physiological function of ASAH2/neutral ceramidase is the metabolism of dietary sphingolipids, and thus plays a role in the generation of messenger molecules such as sphingosine and sphingosine 1-phosphate.
References
  • Tani M, et al. (2000) Molecular cloning of the full-length cDNA encoding mouse neutral ceramidase. A novel but highly conserved gene family of neutral/alkaline ceramidases. J Biol Chem. 275(15): 11229-34.
  • Franzen R, et al. (2002) Nitric oxide induces neutral ceramidase degradation by the ubiquitin/proteasome complex in renal mesangial cell cultures. FEBS Lett. 532(3): 441-4.
  • Kono M, et al. (2006) Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J Biol Chem. 281(11): 7324-31.
  • TOP