Rat Apolipoprotein A-I/ApoA1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGA486-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
780bp
Gene Synonym
apoA-I
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat apolipoprotein A-I Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids and form lipoproteins to translate these oil-soluble lipids such as fat and cholesterol through lymphatic and circulatory system. APOA1 is the main component of high density lipoprotein (HDL) in plasma and is involved in the esterification of cholesterol as a cofactor of lecithin-cholesterol acyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters, and thus play a major role in cholesterol efflux from peripheral cells. As a major component of the HDL complex, APOA1 helps to clear cholesterol from arteries. APOA1 is also characterized as a prostacyclin stabilizing factor, and thus may have an anticlotting effect. Defects in encoding gene may result in HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Men carrying a mutation may develop premature coronary artery disease.
References
  • Toptas B, et al. (2011) Comparison of lipid profiles with APOA1 MspI polymorphism in obese children with hyperlipidemia. In Vivo. 25(3): 425-30.
  • Haase CL, et al. (2011) Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. J Intern Med. 270(2): 136-46.
  • Wu Z, et al. (2011) The low resolution structure of ApoA1 in spherical high density lipoprotein revealed small angle neutron scattering. J Biol Chem. 286(14): 12495-508.
  • TOP