Mouse ApoE/Apolipoprotein E Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009696.3

RefSeq ORF Size

936bp

Gene Synonym

AI255918

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse apolipoprotein E Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

References

Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.

Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.

Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.

Catalog Number:MGA481-CF