Mouse Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA381-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227bp
Gene Synonym
Acy-1, 1110014J22Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse aminoacylase 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.
References
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • TOP