Mouse alpha-Galactosidase A Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA368-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1266bp
Gene Synonym
Ags, Gla
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse galactosidase, alpha Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.
References
  • Koide T.et al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • TOP