Mouse Alpha-2-glycoprotein / AZGP1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA363-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
924bp
Gene Synonym
Zag
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse alpha-2-glycoprotein 1, zinc Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be detected in body fluids such as serum, sweat, and seminal and breast cyst fluids. It has been shown that alpha-2-glycoprotein can stimulate lipolysis by adipocytes in vivo and in vitro. Thus it is believed that alpha-2-glycoprotein plays an important role in the regulation of body weight, and age-dependent changes in genetically influenced obesity, and it also regulates melanin production by normal and malignant melanocytes. Alpha-2-glycoprotein is produced by both white and brown fat adipocytes and may act in a local autocrine fashion in the reduction of adiposity in cachexia.
References
  • Tada T, et al. (1991) Immunohistochemical localization of Zn-alpha 2-glycoprotein in normal human tissues. J Histochem Cytochem. 39(9):1221-6.
  • Vanni H, et al. (2009) Cigarette Smoking Induces Overexpression of a Fat-Depleting Gene AZGP1 in the Human. Chest. 135(5):1197-208.
  • Ueyama H, et al. (1991) Cloning and nucleotide sequence of a human Zn-alpha 2-glycoprotein cDNA and chromosomal assignment of its gene. Biochem Biophys Res Commun. 177(2):696-703.
  • TOP