Rat ALK-6 / BMPR1B Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001024259.1

RefSeq ORF Size

894bp

Gene Synonym

CFK-43a, Bmpr1b

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat bone morphogenetic protein receptor, type IB Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.

References

Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.

Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.

Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.

Catalog Number:MGA347-NM