Mouse ALDH4A1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA323-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1689bp
Gene Synonym
Ahd1, P5cd, Ahd-1, Aldh4, P5cdh, Ssdh1, P5cdhl, P5cdhs, Aldh5a1, E330022C09, A930035F14Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase 4 family, member A1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Additional aldehyde dehydrogenase enzymes detoxify external substances, such as alcohol and pollutants, and internal substances, such as toxins that are formed within cells. ALDH4A1 is expressed abundantly in liver followed by skeletal muscle, kidney, heart, brain, placenta, lung and pancreas. It is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation.
References
  • Goodman SI, et al. (1974) Defective hydroxyproline metabolism in type II hyperprolinemia. Biochemical medicine. 10 (4): 329-36.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138 (1-2): 171-4.
  • Vasiliou V, et al. (2005) Analysis and update of the human aldehyde dehydrogenase (ALDH) gene family. Hum Genomics. 2 (2): 138-43.
  • TOP