Mouse ALDH1A1 / ALDH1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGA314-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1506bp
Gene Synonym
E1; Ahd2; Ahd-2; Aldh1; Raldh1; Aldh1a2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase family 1, subfamily A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that help maintain the transparency of the cornea. Increased ALDH1A1 activity has been found in the stem cell populations of leukemia and some solid tumors. In tumor specimens, increased ALDH1A1 immunopositivity was found not only in secretory type cancer epithelial cells but also in neuroendocrine tumor populations. ALDH1 has been identified as a reliable marker of breast cancer stem cells. ALDH1 expression in primary cancer is an independent prognostic factor in node-positive breast cancer patients. ALDH1A1 plays a key role in normal hematopoiesis, and as a TLX1 transcriptional target, ALDH1A1 may contribute to the ability of this homeoprotein to alter cell fate and induce tumor growth.
References
  • Li T, et al. (2010). ALDH1A1 is a marker for malignant prostate stem cells and predictor of prostate cancer patients' outcome. Lab Invest. 90(2): 234-44.
  • Levi BP, et al. (2009) Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood. 113(8): 1670-80.
  • Rahman FB, et al. (2006) Uncompetitive inhibition of Xenopus laevis aldehyde dehydrogenase 1A1 by divalent cations. Zoolog Sci. 23(3): 239-44.
  • Jester JV, et al. (1999). The cellular basis of corneal transparency: evidence for corneal crystallins. J Cell Sci. 112 ( Pt 5): 613-22.
  • TOP