Mouse AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGA283-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
672bp
Gene Synonym
Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse adenylate kinase 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.
References
TOP