Mouse AK2 / Adenylate kinase 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA282-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
Ak-2; D4Ertd220e
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse adenylate kinase 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adenylate kinase 2 (AK2) belongs to the Adenylate kinase family that contains three isozymes: AK1, AK2 and AK3. Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Adenylate kinase2 (AK2) is expressed in mitochondrial intermembrane space. It may play a role in apoptosis. It has been demonstrated that in apoptotic cells AK2 was translocated into the cytosol concomitantly with cytochronme C. Mutations in this gene are the cause of reticular dysgenesis. These mutations result in absent or strongly decreased protein expression. It has been also established that AK2 is specifically expressed in the stria vascularis region of the inner ear, which provides an explanation of the sensorineural deafness in these individuals. 
References
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106-11.
  • Bruns GA, et al. (1977) Adenylate kinase 2, a mitochondrial enzyme. Biochem Genet. 15 (5-6): 477-86.
  • Khler C, et al. (1999) Release of adenylate kinase 2 from the mitochondrial intermembrane space during apoptosis. FEBS Lett. 447 (1): 10-2.
  • TOP