Rhesus AGRP Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA258-NF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
399bp
Gene Synonym
AGRP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus agouti related protein homolog Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.
References
  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • TOP