Mouse ADAM9 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGA190-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2538bp
Gene Synonym
MDC9, Mltng, AU020942, mKIAA0021, Adam9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ADAM9 (A disintegrin and metallopeptidase domain 9, MDC9, meltrin gamma), is a type 1 transmembrane protein that has been associated with cancer development and metastases. ADAM9 is consistently overexpressed in various human cancers, and plays a role in tumorigenesis in mouse models. ADAM9 cleaves and releases a number of molecules with important roles in tumorigenesis and angiogenesis, such as EGF, FGFR2iiib, Tie-2, Flk-1, EphB4, CD40, VCAM-1, and VE-cadherin, and could represent a potential therapeutic target in tumors where it is highly expressed. ADAM9 belongs to a family of transmembrane, disintegrin-containing metalloproteinases involved in protein ectodomain shedding and cell-cell and cell-matrix interactions. ADAM-9 adhesive domain plays a role in regulating the motility of cells by interaction with beta1 integrins and modulates MMP synthesis.
References
  • Caltabiano R, et al. (2011) ADAM-9 expression in intestinal-type adenocarcinoma of the sinonasal tract. Appl Immunohistochem Mol Morphol. 19(3): 283-7.
  • Peduto L. (2009) ADAM9 as a potential target molecule in cancer. Curr Pharm Des. 15(20): 2282-7.
  • Zigrino P, et al. (2007) Role of ADAM-9 disintegrin-cysteine-rich domains in human keratinocyte migration. J Biol Chem. 282(42): 30785-93.
  • TOP