Canine ACVR2A Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGA178-CF

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1218bp
Gene Synonym
ACVR2A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine activin A receptor, type IIA Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP and ACVR1B. The bovine ACVR2A gene encodes a protein of 513 amino acids which is highly homologous (approximately 98% identity) to the rat, mouse, and human ACVR2A proteins. Inactivation of ACVR2A is a common event in prostate cancer cells suggesting it may play an important role in the development of prostate cancer. The ACVR2A gene is a putative tumor suppressor gene that is frequently mutated in microsatellite-unstable colon cancers (MSI-H colon cancers). Frameshift mutation of ACVR2A may contribute to MSI-H colon tumorigenesis via disruption of alternate TGF-beta effector pathways.
References
  • Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  • Chung H, et al. (2008) Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair. PloS one 3(10): e3463.
  • Fitzpatrick E, et al. (2009) Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia. Molecular human reproduction 15(3):195-204.
  • Roten LT, et al. (2009) Association between the candidate susceptibility gene ACVR2A on chromosome 2q22 and pre-eclampsia in a large Norwegian population-based study (the HUNT study). EJHG. 17(2): 250-7.
  • TOP