Mouse ACP1 / LMW-PTP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001110239.1

RefSeq ORF Size

477bp

Gene Synonym

Acp-1, LMW-PTP, AI427468, 4632432E04Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse acid phosphatase 1, soluble Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

References

Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.

Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.

Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.

Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.

Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.

Catalog Number:MGA150-CM