Mouse 4-1BB/TNFRSF9/CD137 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGA042-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
ILA, Ly63, 4-1BB, Cd137, CDw137, AA408498, AI325004, A930040I11Rik, Tnfrsf9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 9, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + NotI (6kb + 0.66kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials.
References
  • Sica G, et al. (1999) Biochemical and immunological characteristics of 4-1BB (CD137) receptor and ligand and potential applications in cancer therapy. Arch Immunol Ther Exp (Warsz). 47(5): 275-9.
  • Nam KO, et al. (2005) The therapeutic potential of 4-1BB (CD137) in cancer. Curr Cancer Drug Targets. 5(5): 357-63.
  • Wang Q, et al. (2008) Analysis of CD137 and CD137L expression in human primary tumor tissues. Croat Med J. 49(2): 192-200.
  • Melero I, et al. (2008) Multi-layered action mechanisms of CD137 (4-1BB)-targeted immunotherapies. Trends Pharmacol Sci. 29(8): 383-90.
  • Thum E, et al. (2009) CD137, implications in immunity and potential for therapy. Front Biosci. 14: 4173-88.
  • TOP