Rhesus 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGA013-CF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
735bp
Gene Synonym
YWHAB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.
References
  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • TOP