Mouse WTAP Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGI471-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456bp
Gene Synonym
2810408K05Rik, 9430038B09Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Wilms tumour 1-associating protein Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.
References
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • TOP