Human VWC2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGI405-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
978bp
Gene Synonym
PSST739, UNQ739
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human von Willebrand factor C domain containing 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Brorin, also known as brain-specific chordin-like protein, von Willebrand factor C domain-containing protein 2 and VWC2, is a secreted protein which contains two VWFC domains. VWC2 / Brorin is a BMP antagonist which may play a role in neural development. It promotes cell adhesion. VWC2 / Brorin is a unique member of the chordin family. It inhibited the activity of bone morphogenetic protein 2 (BMP2) and BMP6 in mouse preosteoblastic MC3T3-E1 cells. Mouse Brorin was predominantly expressed in neural tissues in embryos and also predominantly expressed in the adult brain. In the brain, the expression was detected in neurons, but not glial cells. The neural tissue-specific expression profile of Brorin is quite distinct from that of any other member of the Chordin family. VWC2 / Brorin protein promoted neurogenesis, but not astrogenesis, in mouse neural precursor cells. VWC2 / Brorin is a novel secreted BMP antagonist that potentially plays roles in neural development and functions.
References
  • Koike,N. et al., 2007, J Biol Chem. 282 (21):15843-50.
  • Elis,S. et al., 2009,Mol Reprod Dev. 76 (11):1043-55.
  • Zhang,J.L. et al., 2010,PLoS One. 5 (9):e12846.
  • TOP