Human VEGF/VEGFA/VEGF165 transcript variant 6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGI349-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
447bp
Gene Synonym
VPF, VEGF, VEGF-A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vascular endothelial growth factor A (VEGFA), transcript variant 6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.
References
  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.
  • TOP