Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGI334-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3201bp
Gene Synonym
VCL, MVCL, CMD1W, Vin
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vinculin (VCL), transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.
References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • TOP