Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:HGI331-NG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2241 bp
Gene Synonym
VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vascular cell adhesion molecule 1, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
KpnI + NotI(6kb+2.24kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.
References
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • TOP