Mouse Vanin-1/VNN1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGI320-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1539bp
Gene Synonym
V-1, Vnn1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse vanin 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pantetheinase, also known as Pantetheine hydrolase, Vascular non-inflammatory molecule 1, Vanin-1, and VNN1, is a cell membrane protein which belongs to the CN hydrolase family and BTD/VNN subfamily. Vanin-1 contains one CN hydrolase domain. It is widely expressed with higher expression in spleen, kidney and blood. It is overexpressed in lesional psoriatic skin. Vanin-1 is also a member of the Vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. Vanin-1 is an epithelial pantetheinase that provides cysteamine to tissue and regulates response to stress. Vanin-1 is expressed by enterocytes, and its absence limits intestinal epithelial cell production of proinflammatory signals. Vanin-1 regulates late adhesion steps of thymus homing under physiological, noninflammatory conditions. The early impact of vanin-1 deficiency on tumor induction was directly correlated to the amount of inflammation and subsequent epithelial proliferation rather than cell death rate. Vanin-1 molecule was shown to be involved in the control of thymus reconstitution following sublethal irradiation.
References
  • Aurrand-Lions M, et al. (1996) Vanin-1, a Novel GPI-Linked Perivascular Molecule Involved in Thymus Homing. Immunity. 5 (5): 391-405.
  • Grimmond S, et al. (2000) Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet. 9 (10): 1553-60.
  • Meghari S, et al. (2007) Vanin-1 controls granuloma formation and macrophage polarization in Coxiella burnetii infection. Eur J Immunol. 37 (1): 24-32.
  • TOP