Human USP7/HAUSP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGI305-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3309bp
Gene Synonym
TEF1, HAUSP, USP7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquitin specific peptidase 7 (herpes virus-associated) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquitin carboxyl-terminal hydrolase 7, also known as Ubiquitin thioesterase 7, Herpesvirus-associated ubiquitin-specific protease, Ubiquitin-specific-processing protease 7, USP7 and HAUSP, is a widely expressed protein which belongs to the peptidase C19 family. USP7 is a member of the family of deubiquitinating enzymes. It is involved in the regulation of stress response pathways, epigenetic silencing and the progress of infections by DNA viruses. USP7 is a protein with a cysteine peptidase core, N- and C-terminal domains required for protein-protein interactions. USP7 contributes to epigenetic silencing of homeotic genes by Polycomb (Pc). USP7 cleaves ubiquitin fusion protein substrates. It deubiquitinates TP53/p53 and MDM2 and strongly stabilizes TP53 even in the presence of excess MDM2. USP7 also induces TP53-dependent cell growth repression and apoptosis. USP7 has key roles in the p53 pathway whereby it stabilizes both p53 and MDM2. Herpes simplex virus type 1 (HSV-1) regulatory protein ICP0 stimulates lytic infection and the reactivation of quiescent viral genomes. ICP0 interacts very strongly with USP7. USP7-mediated stabilization of ICP0 is dominant over ICP0-induced degradation of USP7 during productive HSV-1 infection. The biological significance of the ICP0-USP7 interaction may be most pronounced in natural infection situations, in which limited amounts of ICP0 are expressed.
References
TOP