Human uracil-DNA glycosylase transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_003362.2

RefSeq ORF Size

915bp

Gene Synonym

DGU, UDG, UNG1, UNG2, HIGM4, UNG15, DKFZp781L1143, UNG

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human uracil-DNA.glycosylase, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Isoform 1 is widely expressed with the highest expression in skeletal muscle, heart and testicles. Isoform 2 has the highest expression levels in tissues containing proliferating cells. Uracil-DNA glycosylase exists in two forms: mitochondrial uracil-DNA glycosylase 1 (UNG1) and nuclear uracil-DNA glycosylase 2 (UNG2). uracil-DNA glycosylase. This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. Defects in UNG are a cause of immunodeficiency with hyper-IgM type 5 (HIGM5). A rare immunodeficiency syndrome characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. It results in a profound susceptibility to bacterial infections.

References

Akbari M, et al. (2007) Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress. Neuroscience. 145(4):1201-12.

Slupphaug G, et al. (1996) Properties of a recombinant human uracil-DNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase. Biochemistry. 34(1): 128-38.

Pytel D, et al. (2008) Uracil-DNA glycosylases. Postepy Biochem. 54(4): 362-70.

Catalog Number:HGI282-CY