Human UBE2A/HHR6A Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGI198-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459bp
Gene Synonym
UBC2; HHR6A; MRXSN; RAD6A; MRXS30
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquitin-conjugating enzyme E2A Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquitin-conjugating enzyme E2 A (also known as HHR6A or UBE2A), encoded by human DNA repair genes HHR6A, belongs to the ubiquitin-conjugating enzymes (E2 enzymes) family and is likely to be involved in postreplication repair and induced mutagenesis. UBE2A is described as a CDK2 substrate. It is the human homologue of the product of the Saccharomyces cerevisiae RAD6 / UBC2 gene, a member of the family of ubiquitin-conjugating enzymes. In vivo, HHR6A phosphorylation peaks during the G2/M phase of cell cycle transition, with a concomitant increase in histone H2B ubiquitylation. Mutation of Ser120 to threonine or alanine abolished UBE2A activity, while mutation to aspartate to mimic phosphorylated serine increased UBE2A activity 3-fold. A mutation of UBE2A is consisdered as the cause of a novel X-linked mental retardation (XLMR) syndrome that affects three males in a two-generation family. 
References
  • Nascimento RM, et al. (2006) UBE2A, which encodes a ubiquitin-conjugating enzyme, is mutated in a novel X-linked mental retardation syndrome. Am J Hum Genet. 79 (3): 549-55.
  • Koken MH, et al. (1992) Localization of two human homologs, HHR6A and HHR6B, of the yeast DNA repair gene RAD6 to chromosomes Xq24-q25 and 5q23-q31. Genomics. 12 (3): 447-53.
  • Sarcevic B, et al. (2002) Regulation of the ubiquitin-conjugating enzyme hHR6A by CDK-mediated phosphorylation. EMBO J. 21 (8): 2009-18.
  • TOP