Human UBASH3B / Sts1 / TULA-2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC007541

RefSeq ORF Size

1950bp

Gene Synonym

KIAA1959, MGC15437, STS-1, STS1, TULA-2, p70, UBASH3B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ubiquitin associated and SH3 domain containing, B Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

UBASH3B contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. UBASH3B was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. UBASH3B interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. It promotes accumulation of activated target receptors, such as T-cell receptors and EGFR, on the cell surface. UBASH3B exhibits tyrosine phosphatase activity toward several substrates including EGFR, FAK, SYK, and ZAP70. Down-regulates proteins that are dually modified by both protein tyrosine phosphorylation and ubiquitination.

References

Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.

Carpino N, et al. (2002) Identification, cDNA cloning, and targeted deletion of p70, a novel, ubiquitously expressed SH3 domain-containing protein. Mol Cell Biol. 22(21):7491-500.

Nagase T, et al. (2002) Prediction of the coding sequences of unidentified human genes. XXII. The complete sequences of 50 new cDNA clones which code for large proteins. DNA Res. 8(6):319-27.

Catalog Number:HGI194-NF