Human Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC018210

RefSeq ORF Size

327bp

Gene Synonym

TBCA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human tubulin folding cofactor A Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

References

Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.

Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.

Catalog Number:HGI155-NF