Human TSPAN1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGI088-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
726bp
Gene Synonym
NET1, TM4C, TM4SF, TSPAN1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tetraspanin 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TSPAN1 belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins have four hydrophobic domains, intracellular N- and C-termini and two extracellular domains. Tetraspanins act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane. They also mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN1 interacts with human thiamine transporter-1 (hTHTR-1). HTHTR-1 contributes to intestinal thiamine uptake, and its function is regulated at both the transcriptional and posttranscriptional levels. TSPAN1 and hTHTR-1 colocalize in human intestinal epithelial HuTu-80 cells. Coexpression of TSPAN1 in these cells led to a significant decrease in the rate of degradation of hTHTR-1 compared with cells expressing the hTHTR-1 alone; in fact the half-life of the TSPAN1 protein was twice longer in the former cell type compared with the latter cell type.
References
  • Chen L. et al., 2010, J Korean Med Sci. 25 (10): 1438-42.
  • Chen L. et al., 2010, Tumori. 96 (5): 744-50.
  • Nabokina SM. et al., 2011, Am J Physiol Gastrointest Liver Physiol. 301 (5): G808-13.
  • TOP