Canine TPPP3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGH985-NF

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
531bp
Gene Synonym
TPPP3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine tubulin polymerization-promoting protein family member 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TPPP3, a member of the Tubulin polymerization-promoting protein family, is an intrinsically unstructured protein that induces tubulin polymerization. TPPP3 is a marker in the developing musculoskeletal system. In tendons, Tppp3 is expressed in cells at the circumference of the developing tendons, likely the progenitors of connective tissues that surround tendons: the tendon sheath, epitenon, and paratenon. Tppp3 is also expressed in forming synovial joints. The onset of Tppp3 expression in joints coincides with cavitation, representing a molecular marker that can be used to indicate this stage in joint transition in joint differentiation. In late embryonic stages, Tppp3 expression highlights other demarcation lines that surround differentiating tissues in the forelimb.
References
  • Staverosky JA, et al. (2009) Tubulin polymerization-promoting protein family member 3, Tppp3, is a specific marker of the differentiating tendon sheath and synovial joints. Dev Dyn. 238(3):685-92.
  • Zhou W, et al. (2010) Stable knockdown of TPPP3 by RNA interference in Lewis lung carcinoma cell inhibits tumor growth and metastasis. Mol Cell Biochem. 343(1-2):231-8.
  • TOP