Human TMEM25 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGH851-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
969bp
Gene Synonym
UNQ2531/PRO6030, FLJ14399, TMEM25
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human transmembrane protein 25 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TMEM25 is a novel member of the immunoglobulin superfamily. Immunoglobulin superfamily members are implicated in immune responses, growth factor signaling, and cell adhesion. TMEM25 contains 1 Ig-like (immunoglobulin-like) domain and is a target of pharmacogenomics in the field of oncology and regenerative medicine. TMEM25 isoform 1, consisting of exons 1-9, encoded a 366-aa transmembrane protein. TMEM25 isoform 2, consisting of exons 1-4 and 6-9, encoded a 322-aa secreted protein. TMEM25 mRNA was expressed in brain, including cerebellar cortex and hippocampus, as well as in neuroblastoma, brain tumors, and gastric cancer. Human TMEM25 gene was located at the 11q23.3 oncogenomic recombination hotspot around the MLL amplicon and the neuroblastoma deleted region.
References
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Sugano S, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Katoh M, et al. (2004) Identification and characterization of human TMEM25 and mouse Tmem25 genes in silico. Oncol Rep. 12(2):429-33.
  • TOP